Transposagen | Rat Model ID: Cyp7b1Tn(sb-T2/Bart3)2.306Mcwi

Cyp7b1^{Tn(sb-T2/Bart3)2.306Mcwi}

Insertion Overview

UCSC Blat Alignment
Insertion Location:	intron 1
5' Flanking Sequence:	TATACATGGTCCCAGGTGGCAGCCTAG

Gene
***Rat Entrez Gene If Available; Else Human or Mouse

Symbol:	Cyp7b1
Name:	cytochrome P450, family 7, subfamily b, polypeptide 1
Synonyms:	N/A
Chromosome:	N/A

Mouse Allele

MGI	Symbol	Name	Type
MGI:2182328	Cyp7b1^tm1Lth	targeted mutation 1, Richard Lathe	Targeted (Reporter)
MGI:2387030	Cyp7b1^tm1Rus	targeted mutation 1, David W Russell	Targeted (knock-out)

Associated Diseases

Disease	Disease Class	Sub Category
Alzheimer's Disease	CNS & Neurological Disorder	Neurodegeneration-Mental Behavioral
Spastic Paraplegia 5A	CNS & Neurological Disorder	Paralytic syndromes
Allergic Pulmonary Inflammation	Inflammatory	Respiratory Inflammation
Bile Acid Synthesis Defect	Metabolic Disorders	Liver and Gallbladder Disorders
Gallstones	Metabolic Disorders	Liver and Gallbladder Disorders
Allergic Pulmonary Inflammation	Respiratory	Respiratory Inflammation

Gene Ontology Function Process Component

GO	Term	Evidence	Pubmed
GO:0004497	monooxygenase activity	IEA
GO:0005506	iron ion binding	IEA
GO:0008396	oxysterol 7-alpha-hydroxylase activity	IEA
GO:0008396	oxysterol 7-alpha-hydroxylase activity	ISS
GO:0008396	oxysterol 7-alpha-hydroxylase activity	TAS	12029625
GO:0009055	electron carrier activity	IEA
GO:0020037	heme binding	IEA
GO:0033783	25-hydroxycholesterol 7alpha-hydroxylase activity	IEA
GO:0046872	metal ion binding	IEA

Homologene Orthology (Human/Mouse)

Taxon	Symbol	Synonyms	Chromosome
human	CYP7B1	CBAS3\|CP7B\|SPG5A	N/A
mouse	Cyp7b1	AW261589\|D3Ertd552e\|hct-1	N/A

Related Links

Rat Model Source

Medical College of Wisconsin