Transposagen | Rat Model ID: AdaTn(sb-T2/Bart3)2.237Mcwi

Ada^{Tn(sb-T2/Bart3)2.237Mcwi}

Insertion Overview

UCSC Blat Alignment
Insertion Location:	intron 7
5' Flanking Sequence:	TAGGTTCCTGGGTTCAAACTCAGGTTGTCATGCTTTGTGGAAGGCACCTT CACCCACTGAGCCATCTTACCAGTTCCAGAATTTGACACTTGACTTTTCT CAAAGCACTATTCCTAG

Gene
***Rat Entrez Gene If Available; Else Human or Mouse

Symbol:	Ada
Name:	adenosine deaminase
Synonyms:	MGC108610
Chromosome:	N/A

Mouse Allele

MGI	Symbol	Name	Type
MGI:1857117	Ada^tm1Mw	targeted mutation 1, Maki Wakamiya	Targeted (knock-out)
MGI:2155977	Ada^tm1Vlr	targeted mutation 1, Dinko Valerio	Targeted (knock-out)

Associated Diseases

Disease	Disease Class	Sub Category
Severe Combined Immune Deficiency (SCID)	Immune

Gene Ontology Function Process Component

GO	Term	Evidence	Pubmed
GO:0001883	purine nucleoside binding	IDA	3746429\|4462574\|6815190
GO:0004000	adenosine deaminase activity	IDA	3746429\|4462574\|6815190\|11038259\|12675911
GO:0004000	adenosine deaminase activity	IEA
GO:0004000	adenosine deaminase activity	ISS
GO:0005515	protein binding	IEA
GO:0005515	protein binding	ISS
GO:0008270	zinc ion binding	IEA
GO:0008270	zinc ion binding	ISS
GO:0016787	hydrolase activity	IEA

Gene Ontology Function Process Component

GO	Term	Evidence	Pubmed
GO:0001666	response to hypoxia	IEA
GO:0001666	response to hypoxia	ISS
GO:0001701	in utero embryonic development	ISS
GO:0001829	trophectodermal cell differentiation	ISS
GO:0001889	liver development	ISS
GO:0001890	placenta development	ISS
GO:0002314	germinal center B cell differentiation	ISS
GO:0002636	positive regulation of germinal center formation	ISS
GO:0002906	negative regulation of mature B cell apoptosis	ISS
GO:0006154	adenosine catabolic process	IEA
GO:0006154	adenosine catabolic process	ISS
GO:0006157	deoxyadenosine catabolic process	ISS
GO:0006955	immune response	IEA
GO:0007568	aging	IEP	2982653
GO:0009168	purine ribonucleoside monophosphate biosynthetic process	IEA
GO:0030324	lung development	ISS
GO:0030890	positive regulation of B cell proliferation	ISS
GO:0032261	purine nucleotide salvage	IEA
GO:0032261	purine nucleotide salvage	ISS
GO:0033197	response to vitamin E	IDA
GO:0033632	regulation of cell-cell adhesion mediated by integrin	IEA
GO:0033632	regulation of cell-cell adhesion mediated by integrin	ISS
GO:0042110	T cell activation	IEA
GO:0042110	T cell activation	ISS
GO:0042493	response to drug	IEP
GO:0042542	response to hydrogen peroxide	IEP	15966013
GO:0043066	negative regulation of apoptosis	ISS
GO:0045187	regulation of circadian sleep/wake cycle, sleep	IEP	11038259
GO:0045580	regulation of T cell differentiation	ISS
GO:0045582	positive regulation of T cell differentiation	ISS
GO:0046061	dATP catabolic process	ISS
GO:0046085	adenosine metabolic process	IDA	3746429\|4462574\|6815190\|12675911
GO:0046085	adenosine metabolic process	TAS	11038259
GO:0046101	hypoxanthine biosynthetic process	ISS
GO:0046103	inosine biosynthetic process	IEA
GO:0046103	inosine biosynthetic process	ISS
GO:0046111	xanthine biosynthetic process	ISS
GO:0048286	alveolus development	ISS
GO:0048541	Peyer's patch development	ISS
GO:0048566	embryonic gut development	ISS
GO:0050728	negative regulation of inflammatory response	ISS
GO:0050870	positive regulation of T cell activation	ISS
GO:0060169	negative regulation of adenosine receptor signaling pathway	IEA
GO:0060169	negative regulation of adenosine receptor signaling pathway	ISS

Homologene Orthology (Human/Mouse)

Taxon	Symbol	Synonyms	Chromosome
human	ADA	N/A	N/A
mouse	Ada	N/A	N/A

Related Links

Taxon	Database	Identifier
rat	Ensembl	ENSRNOG00000010265
rat	RATMAP	23
rat	RGD	2031
human	Ensembl	ENSG00000196839
human	HGNC	186
human	HPRD	00038
human	MIM	608958
mouse	Ensembl	ENSMUSG00000017697
mouse	MGI	MGI:87916

Rat Model Source

Medical College of Wisconsin